CRISPR guide design, computationally real.
Submit a DNA sequence and get every candidate SpCas9 guide RNA (20bp adjacent to a real NGG PAM), scored with the same class of rules public tools like CRISPOR use: GC-content and poly-T checks, plus off-target similarity via the position-weighted mismatch formula from Hsu et al. 2013. Scope: computational design and scoring only — no synthesis ordering, no wet-lab integration, and off-target scoring is against candidate sites within your own submitted sequence, not a full genome.
Live example — top 5 of 26 candidates found
| Guide (20bp) | Strand | GC% | Poly-T | Off-target sim. | Recommended |
|---|---|---|---|---|---|
| GTGACTGACCTGATCGATCC | + | 55% | no | 0 | ✓ |
| GGTACCTGACGTCATTGTAA | + | 45% | no | 0 | ✓ |
| GTACCTGACGTCATTGTAAT | + | 40% | no | 0 | ✓ |
| CATTGTAATGGGCCGCTGAA | + | 50% | no | 0 | ✓ |
| ATTGTAATGGGCCGCTGAAA | + | 45% | no | 0 | ✓ |